La siguiente publicación técnica esta relacionada al evento:
XXXVIII Congreso Sociedad Chilena de Producción Animal (SOCHIPA)

Detección de Brachyspira Pilosicoli en cerdos en Chile

Publicado el: 30/8/2014
Autor/es:

Introducción

En producción porcina, hoy día son las enfermedades sub-clínicas y aquellas que afectan la eficiencia de conversión alimentaria las que representan un mayor desafío productivo. La espiroquetosis intestinal porcina cuyo agente etiológico es Brachyspira pilosicoli, está dentro de las patologías emergentes que presentan estas características (4) y de la cual existe sospecha clínica y patológica en el país. Corresponde a una enfermedad digestiva causante de colitis crónica moderada, diarrea con contenido mucoso, usualmente sin sangre que afecta a cerdos que entre 4 y 20 semanas de edad (4). Son necesarios métodos de diagnóstico rápidos y específicos para la detección de B. pilosicoli, por su impacto económico en la producción porcina. El presente trabajo pretende detectar esta especie mediante la implementación de una técnica mixta de cultivo específico material fecal y su posterior confirmación mediante técnicas bioquímicas y moleculares.

Existen evidencias de que B. pilosicoli es causante además, de un síndrome de espiroquetosis intestinal en humanos (5), habiéndose demostrado que los aislamientos de porcinos, perros y humanos están relacionados genéticamente (1). Sin embargo, la evidencia de trasmisión zoonótica sólo se ha confirmado entre perros y humanos (4).
 

Materiales y métodos

Este trabajo se realizó entre julio de 2011 y noviembre de 2012. Se implementó la detección de B. pilosicoli en cerdos en etapa de crecimiento-engorda a partir de muestras de heces.

En el estudio se incluyeron 9 planteles distribuidos en cuatro regiones administrativas del país (Metropolitana, del Libertador Bernardo O´Higgins, del Maule y de Los Lagos), donde se sospechaba de su presencia, debido a episodios de diarrea y baja ganancia diaria de peso. Se muestrearon 170 cerdos de entre 30-35 a 105-120 kg de peso vivo, no tratados con antibióticos 20 días previos al muestreo.

Las muestras fueron tomadas desde heces frescas o directamente desde el recto mediante tórulas con medio de transporte Cary-Blair (COPAN, Murrieta, CA, USA) y mantenidas en refrigeración hasta su procesamiento en el laboratorio antes de 48 horas de colectadas. Las tórulas fueron sembradas en placas Petri con medio tripticasa soya (Bacton, Dickinson & Co., Le Pont de Claix,France) con 5% de sangre ovina estéril y con la adición de espectinomicina 200 mg/L, vancomicina 50 mg/L, rifampicina 12.5 mg/L y colistina 12.5 mg/L (3). Las placas previamente reducidas fueron incubadas en anaerobiosis (Gaspak®, BBL, Division of ioQuest Cockeysville, Maryland. Div. Becton, Dickinson & Co) por 5 a 7 días a 37ºC.

Los cultivos sospechosos con desarrollo bacteriano en película y presencia de hemólisis, fueron repicados para obtener cultivos puros y extraer ADN. Posteriormente se realizó un ensayo de PCR para la detección del gen 16S rDNA de B. pilosicoli utilizando los partidores P1 (AGAGGAAAGTTTTTTCGCTTC) y P2 (GCACCTATGTTAAACGTCCTTG) según un protocolo descrito previamente (2).
 

Resultados y discusión

Se obtuvieron 9 (5,3%) muestras positivas al PCR en 3 (33,3%) planteles. Para confirmar este hallazgo, un producto de 823 bp del gen 16S rDNA de B. pilosicoli fue purificado y secuenciado (Genbank N° JX486100), demostrando una identidad completa con otras secuencias publicadas del mismo gen (Genbank N° JF430717 Suecia, HM450982 Tailandia, CP002025 Australia, NR025674 Francia, AB120008 Japón). Estos resultados confirman la presencia de Brachyspira pilosicoli en Chile.

Se recomienda establecer un estudio para caracterizar la presencia del agente en el país, reforzar las medidas sanitarias para su control y desarrollar vigilancia epidemiológica de este agente emergente potencialmente zoonótico.


Conclusiones

Se logró aislar y caracterizar fenotípicamente cepas de B. pilosicoli en heces de cerdos en planteles porcinos de deferentes regiones de Chile. Se logró confirmar, por primera vez en Chile, la presencia de B. pilosicoli mediante prueba de PCR y secuenciación.


Referencias

  • HAMPSON DJ and LEE JI. 1994. Genetic characterisation of intestinal spirochaetes and their association with disease. J. Med. Microbiol. 40: 365-371.
  • LA T, PHILLIPS ND and HAMPSON DJ. 2003. Development of a duplex PCR assay for detection of Brachyspira hyodysenteriae and Brachyspira pilosicoli in pig feces. J. Clin. Microbiol. 41: 3372-3375.
  • NOVOTNA M and SKARDOVA O. 2002 Brachyspira hyodysenteriae: detection, identification and antibiotic susceptibility. Vet. Med. – Czech. 47: 104-109.
  • TROTT DJ, STANTON TB, JENSEN NS, DUHAMEL GE, JOHNSON JL and HAMPSON DJ. 1996. Serpulina pilosicoli sp. nov., the agent of porcine intestinal spirochetosis. Int. J. Syst. Bacteriol. 46: 206-215.
  • TROTT DJ, JENSEN NS, SAINT GIRONS I, OXBERRY S, STANTON TB, LINDQUIST D and HAMPSON DJ. 1997. Identification and characterization of Serpulina pilosicoli isolates recovered from the blood of critically Ill patients. J Clin Microbiol. 35: 482-485.
 
remove_red_eye 640 forum 1 bar_chart Estadísticas share print
Compartir:
close
Ver todos los comentarios
 
   | 
Copyright © 1999-2019 Engormix - All Rights Reserved