Engormix/Porcicultura/Artículos técnicos

Biotecnología: Una arma eficaz ante el reto del vPRRS (Parte I)

Publicado el: 13/2/2018
Autor/es: Dr. Manuel Albetis Apolaya - Docente Investigador, Facultad de Medicina Veterinaria Universidad Nacional “San Luis Gonzaga” de Ica. Perú
Las vacunaciones se realizaban inactivando el virus para el que se quería vacunar, inyectándolo después en las personas. Ahora las vacunas se producen mediante ingeniería genética y contienen moléculas aisladas que inducen la respuesta inmune.
Biotecnología: Una arma eficaz ante el reto del vPRRS (Parte I) - Image 1
Introducción
Nos encontramos frente a una nueva “Revolución Industrial” llamada Biotecnología, no basada en hierro y acero sino en microbios que, en manos de científicos, se convierten en minúsculas fábricas para producir fármacos, compuestos químicos industriales, combustibles o alimentos.
La Biotecnología está presente en la medicina y en la salud animal, participando tanto en el diagnóstico como en el tratamiento de enfermedades. Con la Biotecnología cambia el concepto de la Salud, dirigiéndonos hacia una medicina cada vez más personalizada. Esto significa que podemos tener tratamientos “hechos a medida” para nosotros, así nos curan de forma más eficaz. Cada vez más medicamentos en nuestro hogar son de origen biotecnológico.
Pero ¿cuándo empezó la Biotecnología en la medicina? A partir del descubrimiento del ADN por Watson y Crick, se empezó a desarrollar lo que se llama Biología Molecular, que ha permitido descubrir genes, determinar su función en el organismo y estudiar su participación en el desarrollo de enfermedades. Así, la secuenciación del Genoma Humano ha marcado un antes y un después en la historia de la medicina al permitir el estudio de las bases genéticas de las enfermedades (el 80% de las enfermedades adultas tienen una base genética con influencia de factores ambientales y existen miles de genes relacionados con el desarrollo de enfermedades). De hecho, la investigación de genes y proteínas (genómica y proteómica), la ingeniería genética y sus aplicaciones han permitido el desarrollo de nuevas herramientas que están revolucionando la prevención, el diagnóstico, el tratamiento y la curación de enfermedades. KENNEDY, M.J. (1991).
La Biotecnología también ha cambiado la manera en la que se diseñan las vacunas. Tradicionalmente, las vacunaciones se realizaban inactivando el virus para el que se quería vacunar, inyectándolo posteriormente en las personas. Ahora las vacunas se producen mediante ingeniería genética y contienen moléculas aisladas que inducen la respuesta inmune.
Biotecnología: Una arma eficaz ante el reto del vPRRS (Parte I) - Image 2
Definición y principios
Según la Organización de Cooperación y Desarrollo Económicos: Es la aplicación de los principios científicos y de la ingeniería al procesamiento de materiales por agentes biológicos para proveer bienes de servicios. Intervienen muchas disciplinas que ponen especial énfasis en la microbiología, Bioquímica, Biología Molecular, Genética, Inmunología e Ingeniería Bioquímica y Química.
Uso en la Salud y Producción animal
  • Vacunas (desarrollo de vacunas por procedimiento que utilicen ingeniería genética).
  • Reactivos de diagnóstico: Desarrollo de reactivos por técnicas inmunológicas (enzimo-inmunoensayos o por ingeniería genética).
  • Desarrollo de métodos para el diagnóstico de enfermedades animales.
  • Producción de nuevas vacunas virales, bacterianas y parasitarias por técnica de avanzada.
  • Manipulación y sexado de embriones.
  • Hormonas para el mejoramiento de la producción animal.
HERRAMIENTAS Y PRINCIPIOS
PCR TIEMPO REAL
Características de la RT- PCR
La PCR en tiempo real (o PCR cuantitativa) surgió para resolver el problema de la cuantificación de la técnica de la PCR. En la PCR en tiempo real se emplean sondas marcadas con fluorocromos. Las sondas de hidrólisis, frecuentemente empleadas en esta técnica, son oligonucleótidos que presentan fluorocromos en ambos extremos y tienen una secuencia complementaria a parte del fragmento de ADN que se quiere amplificar. Uno de los fluorocromos actúa como donador de fluorescencia en el extremo 5’ y el otro como aceptor de esta fluorescencia en el extremo 3’. La ADN polimerasa se desplaza sobre la cadena de ADN sintetizando la cadena complementaria a partir de un fragmento de ADN que sirve de molde (cebador). Al llegar al punto en el que la sonda se ha hibridado, la hidroliza. El fluorocromo del extremo 5’ de la sonda (el donador) es liberado. El fluorocromo aceptor no puede entonces absorber la fluorescencia del donador por estar alejado de él espacialmente. Un detector realiza la medida de esta emisión de fluorescencia, que es proporcional a la cantidad de ADN presente, y la representa gráficamente Mackay, 2077.
Componentes de la reacción
Biotecnología: Una arma eficaz ante el reto del vPRRS (Parte I) - Image 3
Aplicaciones de la RT-PCR
Determinación agentes patógenos
Expresión génica en tejido en diferentes estadios de la enfermedad o tras tratamiento de deleción o amplificación de genes, discriminación alélica, diagnóstico clínico de tumores o respuesta a tratamiento, genotipado, detección de SNPs, haplotipo, validación de resultados de experimentos con arrays, metilación de DNA y estudio de apoptosis y monitorización de patrones de expresión de citoquinas.
Una aplicación en la salud porcina: Síndrome Reproductivo y Productivo Porcino (PRRS)
Si deseamos determinar la presencia del vPRRS (Agente patógeno) en una de nuestras granjas cualquiera, primero tenemos que conocer al virus, por eso es importante conocer la biología molecular, la cual nos ayudará a determinar la organización del genoma. En el gráfico, Genoma Viral del PRRS.
Biotecnología: Una arma eficaz ante el reto del vPRRS (Parte I) - Image 4
El genoma del virus PRRS es una molécula de ARN lineal de banda única, poliadenilado, y polaridad positiva de aproximadamente 15 kb. que ha sido secuenciado en su totalidad, en varios aislados americanos y en el aislado europeo de Lelystad. Contiene 8 fases de lectura abierta (ORFs) solapantes, denominados ORF1a, ORF1b, y ORFs 2 a 7, en sentido 5´ a 3´, organizados de forma similar a los coronavirus. Vizcaino (2008).
Biotecnología: Una arma eficaz ante el reto del vPRRS (Parte I) - Image 5
La importancia del RT-PCR en el control del PRRS, como sabemos esta enfermedad es producida por un virus ARN cuyas principales características son la variabilidad genética y antigénica, sus propiedades inmunomoduladoras y su capacidad para inducir infecciones persistentes. Hasta el momento se han reconocido dos genotipos principales del virus de PRRS, el europeo (EU) y el americano (NA) Benfield et al., 1999. La comparación de sus secuencias ha mostrado diferencias genéticas significativas entre ellos, Van Woesel et al., 1998, lo que contribuye a que la vacunación sea poco efectiva. Uno de los métodos más empleados para el diagnóstico de PRRS es la RTPCR que, acompañada de secuenciación, nos permite determinar el genotipo viral. En los últimos años se han empezado a desarrollar nuevas técnicas de RTPCR en tiempo real que suponen una mejora sobre las convencionales debido a que presentan ventajas como su mayor sensibilidad, la posibilidad de cuantificar la carga viral o el ahorro de tiempo y material, mejorando el control de la enfermedad.
Un trabajo realizado en España por Rubio et al. (2007), analizaron 20 muestras de suero, se detectaron dos muestras positivas. La interpretación de los resultados se llevó a cabo mediante la curva de amplificación (Imagen 1) y la curva de disociación (Imagen 2). Previamente se diseñó un primer forward ATGGCCAGCCAGTCAATCA y primer reverse CGGATCAGGCGCACAGTATG) (Shin y col 1998), para conseguir la amplificación de un fragmento del ORF 7 del genoma viral de 286 pares de bases. Se eligió el ORF 7 porque es la región más conservada del genoma viral.
Biotecnología: Una arma eficaz ante el reto del vPRRS (Parte I) - Image 6
Biotecnología: Una arma eficaz ante el reto del vPRRS (Parte I) - Image 7
Biotecnología: Una arma eficaz ante el reto del vPRRS (Parte I) - Image 8
Con la curva de amplificación se observa la sensibilidad de la técnica, mediante la determinación del ciclo umbral, y con la curva de disociación se evidencia la especificidad de la amplificación.
Una vez detectadas las muestras positivas se enviaron a secuenciar con la técnica de RFLP (Restriction Fragment Length Polymorphism) que es la secuenciación genética inferida mediante el uso de enzimas de restricción y sus secuencias de restricción correspondiente; una vez disponibles las secuencias, se alinearon con la base de datos del GeneBank, procediendo a la posterior identificación de la cepa mediante el empleo del programa BLAST.
Pudiéndose hacer una genotipificación del VPRRS en México (Lara-Puente 2013) encontrándose 15 diferentes patrones de RFLP vPRRS 2013. (Ver gráfico).
Esta secuenciación del vPRRS es gracias a la bioinformática. La variabilidad genética se produce como consecuencia de diversos mecanismos.
  • Mutaciones, es uno de los principales mecanismos de variabilidad que se producen durante la replicación del virus, estos errores se producen de forma aleatoria por lo que cada nuevo virus producido es ligeramente diferente a su parental.
  • Recombinación, se presenta cuando un animal se enfrenta a varias cepas distintas y puede haber una combinación de fragmentos de genoma generando nuevos virus recombinantes.
Esta variabilidad genética se refleja también en variabilidad antigénica teniendo un efecto sobre la protección que pueden aportar las vacunas.
Biotecnología: Una arma eficaz ante el reto del vPRRS (Parte I) - Image 9

 
Autor/es:
 
Visualizaciones238Comentarios0EstadísticasCompartir