Engormix
Ingresar o registrarme
Engormix.com
La siguiente publicación técnica esta relacionada al evento:
XXII Congreso Latinoamericano de Avicultura 2011

Neumonia en aves

Primeros aislamientos de Ornithobacterium rhinotracheale ß–hemolíticos en América Latina y su asociación a neumonía en pollos parrilleros

Publicado el:
Autor/es:
(1210)
(1)
Resumen

Muestras de pulmones y tráqueas pertenecientes a dos explotaciones de pollos parrilleros de 40 y 46 días de vida, en donde se había observado signología respiratoria severa, edema facial y mortandad, fueron analizadas mediante estudios bacteriológicos, histopatológicos y moleculares. En ambos casos, la necropsia de campo reveló lesiones compatibles con neumonía. La bacteriología arrojó el crecimiento de colonias grisáceas y pequeñas similares a Ornithobacterium rhinotracheale con una extensa actividad β-hemolítica observada en ambos aislamientos de campo. Ornithobacterium rhinotracheale fue identificado mediante la técnica en reacción en cadena de la polimerasa (PCR). Los hallazgos histopatológicos de los pulmones revelaron neumonía fibrinoheterofílica. El aislamiento e identificación de cepas β-hemolíticas de O. rhinotracheale es reportado por primera vez en América Latina junto con su asociación a neumonía en pollos parrilleros.
Palabras Clave: Ornithobacterium rhinotracheale, β-hemólisis, Pollos parrilleros, Neumonía.

Summary

Lung and trachea samples from 40-day-old and 46-day-old broiler chicken flocks with severe respiratory clinical signs, facial edema and mortality were analyzed by bacteriologic, histopathologic and molecular studies. At field necropsy, both cases showed pneumonic lesions. Small and grey colonies similar to Ornithobacterium rhinotracheale with an intense β-hemolytic activity were isolated from both cases. They were identified as Ornithobacterium rhinotracheale by polymerase chain reaction (PCR). Histopathology of lungs revealed fibrinoheterophilic pneumonia. The isolation and identification of O. rhinotracheale strains with β-hemolytic activity associated with pneumonia in broiler chickens is reported for the first time in Latin America.

Key Words: Ornithobacterium rhinotracheale, β-hemolysis, broiler chickens, pneumonia.

Resumen

Muestras de pulmones y tráqueas pertenecientes a dos explotaciones de pollos parrilleros de 40 y 46 días de vida, en donde se había observado signología respiratoria severa, edema facial y mortandad, fueron analizadas mediante estudios bacteriológicos, histopatológicos y moleculares. En ambos casos, la necropsia de campo reveló lesiones compatibles con neumonía. La bacteriología arrojó el crecimiento de colonias grisáceas y pequeñas similares a Ornithobacterium rhinotracheale con una extensa actividad β-hemolítica observada en ambos aislamientos de campo. Ornithobacterium rhinotracheale fue identificado mediante la técnica en reacción en cadena de la polimerasa (PCR). Los hallazgos histopatológicos de los pulmones revelaron neumonía fibrinoheterofílica. El aislamiento e identificación de cepas β-hemolíticas de O. rhinotracheale es reportado por primera vez en América Latina junto con su asociación a neumonía en pollos parrilleros.

Palabras Clave: Ornithobacterium rhinotracheale, β-hemólisis, Pollos parrilleros, Neumonía.

Introducción

Ornithobacterium rhinotracheale es un bacilo GRAM (-), pleomórfico, inmóvil, no esporulado con propiedades bioquímicas inconsistentes y considerado como un microorganismo no hemolítico (Chin & Charlton, 2008; Chin et al., 2008). Sin embargo, recientemente fue comprobada su actividad β-hemolítica en aislamientos de campo en Norte América (Tabatabai et al., 2010; Walters et al., 2009). Su crecimiento es óptimo en agar sangre 5-10 % con el adicionado de gentamicina y polimixina. Sus colonias se caracterizan por ser puntiformes y grisáceas (van Empel & Hafez, 1999). El aislamiento e identificación de O. rhinotracheale y/o la detección de anticuerpos son técnicas capaces de establecer el diagnóstico definitivo de la ornitobacteriosis (Chin et al., 2008). Así también, la reacción en cadena de la polimerasa (PCR) puede ser utilizada con propósitos de identificación bacteriana (van Empel & Hafez, 1999) y/o con fines diagnósticos (Hafez, 2002). La infección causada por O. rhinotracheale se caracteriza por ocasionar en pollos parrilleros de tres a seis semanas de edad, cuadros clínicos compuestos por depresión, reducción del consumo alimenticio, reducción de la ganancia diaria de peso, descarga nasal, estornudos, edema facial, muerte súbita y mortandades que varían entre el 2 % y el 10 % (Chin et al., 2008). Ornithobacterium rhinotracheale también se encuentra asociado a incrementos del 5% al 10% en las tasas de decomiso, pudiendo llegar hasta un 90% durante los meses invernales (Chin et al., 2008; Sakai et al., 2000; van Veen et al., 2000a). La enfermedad respiratoria causada por O. rhinotracheale ocasiona neumonía y aerosaculitis (Chin et al., 2008). Las infecciones producidas por O. rhinotracheale, Pasteurella multocida, Escherichia coli y Staphyloccocus sp son las principales causantes de afecciones pulmonares de origen bacteriano en aves de corral (Fletcher et al., 2008). Las lesiones originadas por O. rhinotracheale y P. multocida se caracterizan por presentar áreas extensas de necrosis con edema y acumulación de fibrina y heterófilos en el tejido intersticial y en los pasajes aéreos. Fletcher (2010) describe a los cuadros neumónicos causados por O. rhinotracheale como neumonías difusas, fibrinosas y heterofílicas.

El presente trabajo tiene como objetivo la descripción de los hallazgos microbiológicos, histopatológicos y moleculares encontrados en dos parvadas de pollos parrilleros afectadas por O. rhinotracheale β-hemolítico.

Materiales & Métodos

En septiembre del 2010 fueron remitidos al Laboratorio de Diagnóstico de Enfermedades de las Aves y los Pilíferos (Cátedra de Patología de Aves y Pilíferos, Facultad de Ciencias Veterinarias, Universidad Nacional de La Plata, Buenos Aires, Argentina), pulmones y tráqueas refrigeradas. Las muestras provinieron de dos explotaciones comerciales de pollos parrilleros, de 40 y 46 días de edad, localizadas en la provincia de Buenos Aires, Argentina. En ambas granjas se pudo observar un cuadro clínico respiratorio severo, edema facial y una mortandad que alcanzó el 10%, en el segundo de los casos.

Muestras de esos órganos fueron fijadas en formol neutro al 10 %, embebidas en parafina, seccionadas a un espesor de 4 µm aproximadamente y teñidas con hematoxilina y eosina para su estudio histopatológico. Por su parte, el estudio bacteriológico consistió en la siembra de hisopados traqueales y homogenizaciones del tejido pulmonar en agar sangre 10 % con 5 µg/ml de gentamicina cuya incubación se prolongó durante 48 horas a 37°C en condiciones microaerofílicas. Las placas que mostraron colonias bacterianas similares a O. rhinotracheale, fueron dejadas otras 48 hs a temperatura ambiente, según recomendaciones descriptas por Tabatabai y col. (2010). La identificación posterior fue realizada mediante la tinción de GRAM, las pruebas bioquímicas de oxidasa y catalasa y a través de PCR en tiempo real usando SYBR Green(IQTM SYBR® Green Supermix, BIO -RAD). La extracción de ADN (ácido desoxirribonucleico) de los aislamientos obtenidos fue lograda mediante el uso del kit comercial DNeasy Blood and Tissue Kit® (QIAGEN), siguiendo las recomendaciones del fabricante. En la prueba de PCR se utilizaron los primers OR16S-F1 (5´ GAGAATTAATTTACGGATTAAG 3´) y OR16S- R1

(5´ TTCGCTTGGTCTCCGAAGAT 3´) (Hafez, 2002), junto a un ciclado que detalladamente se encuentra descripto en la Tabla 1. Finalmente, los productos de PCR obtenidos de ambos casos junto a los de un control positivo no hemolítico (AWC 9379), un control negativo y a los de aislamientos no hemolíticos de O. rhinotracheale logrados en nuestro laboratorio, fueron sembrados en un gel de agarosa al 1,5% y sometidos a una corrida electroforética para su posterior tinción con bromuro de etidio y visualización con luz ultravioleta.

Tabla 1. Ciclado de PCR para la detección de O. rhinotracheale

Ciclo1

Paso 1

94°C

Ciclo 2

(45x)

Paso 1

Paso 2

Paso 3

30´´

1´ 30´´

94°C

52°C

72°C

Ciclo 3

Paso 1

72°C

Ciclo 4

(66x)

Paso 1

30´´

82°C

El cambio de temperatura fue 0,2°C y la temperatura final fue 95°C.

Resultados & Discusión

En ambos casos, O. rhinotracheale fue aislado a partir de tráqueas y pulmones. Fue observado como bacilos GRAM (-), catalasa (-), oxidasa (+) e identificado por medio de la técnica de PCR. La bacteriología destacó la presencia de una β-hemólisis extensa circundando a las colonias de O.

rhinotracheale de ambos aislamientos dentro de las 48 hs posteriores a la incubación, en concordancia con lo descripto por Tabatabai et al. (2010). Los productos de PCR de los

aislamientos β-hemolíticos de O. rhinotracheale mostraron un peso molecular de 784 pb (pares de bases), similar al del control positivo no hemolítico y a los de los aislamientos de campo no hemolíticos de O. rhinotracheale obtenidos por nuestro Laboratorio durante los años 2009 y 2010. Las lesiones histopatológicas halladas en los pulmones de ambos casos estuvieron constituidas por áreas con acumulación de edema, fibrina y heterófilos en los pasajes aéreos y en tejido intersticial junto con la presencia de escasas áreas de necrosis distribuidas en el parénquima pulmonar. No fueron encontradas lesiones microscópicas en las tráqueas estudiadas.

Estudios experimentales pudieron comprobar la capacidad primaria de O. rhinotracheale para producir enfermedad en aves de corral (van Veen et al., 2000b), a pesar de la influencia de diversos factores inmunodepresores capaces de incrementar su capacidad patógena (Hoerr, 2010). Numerosos autores consideran que O. rhinotracheale debería ser incluido dentro de los agentes infecciosos causantes de neumonías en pollos parrilleros con cuadros respiratorios, esto debido en parte a su función patógena primaria o bien a su asociación con otras causas primarias de enfermedad. En Latinoamérica, el aislamiento de O. rhinotracheale fue logrado en México (Soriano et al., 2002), Perú (Hung & Alvarado, 2001), Brasil (Canal et al., 2005) y Argentina (Uriarte et al., 2009), aunque sin la descripción de actividad hemolítica.

Conclusiones

El presente trabajo describe por primera vez en América Latina el aislamiento de cepas β-hemolíticas de O. rhinotracheale en asociación con la presencia de neumonía en pollos parrilleros. A pesar que las cepas no hemolíticas y hemolíticas de O. rhinotracheale analizadas en este trabajo no mostraron diferencias al comparar los pesos moleculares de sus productos de PCR, futuros estudios de campo, laboratorio y experimentales son considerados necesarios para poder

determinar si la capacidad hemolítica mostrada por estos y futuros aislamientos β-hemolíticos de O. rhinotracheale se encuentra vinculada a una posible virulencia bacteriana incrementada. Además, se debe conocer la relación entre las lesiones encontradas en pulmones, tráquea y sacos aéreos y los aislamientos hemolíticos y no hemolíticos de O. rhinotracheale obtenidos de dichos órganos.

Bibliografía

Canal CW, Leão JA, Rocha SLS, Macagnan M, Lima-Rosa CAV, Oliveira CD, Back A. 2005. Isolation and characterization of Ornithobacterium rhinotracheale from chickens in Brazil. Res. Vet. Sci. 78:225-230.

Chin RP & Charlton BR. 2008. Ornithobacteriosis. pp 75-76. In: A Laboratory Manual for the Isolation, Identification and Characterization of Avian Pathogens, 5ta ed., Dufour-Zavala L, Swayne DE, Glisson JR, Pearson JE, Reed JW, Jackwood MW, Woolcock PR (eds). American Association of Avian Pathologists, Madison, Wisconsin, USA.

Chin RP, van Empel PCM, Hafez HM. 2008.Ornithobacterium rhinotracheale infection. pp. 765-774. In: Diseases of Poultry. Saif YM, Fadly AM, Glisson JR, McDougald LR, Nolan LK, Swayne DE (eds). Blackwell Publishing Ltd., Oxford, UK.

Fletcher OJ, Abdul-Aziz T, Barnes HJ. 2008. Respiratory System. pp. 128-163. In: Avian histopathology. Fletcher OJ & Abdul-Aziz T (eds.). American Association of Avian Pathologists, Madison, Wisconsin, USA.

Fletcher OJ. 2010. Avian Histopathology in the Digital Age, update on virtual slides. Respiratory System, 4.3 Lung. URL: http://www.ncsu.edu/project/poultryhealth/fletcher/cbs595/learning-module 04/LM4LC3Master/LM4LC3/LM4-LC3-all.html. Acceso: Junio-2010.

Hafez HM. 2002. Diagnosis of Ornithobacterium rhinotracheale. Int. J. Poult. Sci. 1(5):114-118.

Hoerr FJ. 2010. Clinical aspects of immunosuppression in poultry. Avian Dis. 54:2-15.

Hung AL & Alvarado A. 2001. Phenotypic and molecular characterization of isolates of Ornithobacterium rhinotracheale from Peru. Avian Dis. 45:999-1005.

Sakai E, Tokuyama Y, Nonaka F, Ohishi S, Ishikawa Y, Tanaka M, Taneno A. 2000. Ornithobacterium rhinotracheale infection in Japan: preliminary studies. Vet. Rec. 146:502-503.

Soriano VE, Longinos MG, Navarrete PG, Fernández RP. 2002. Identification and characterization of Ornithobacterium rhinotracheale isolates from Mexico. Avian Dis. 46:686-690.

Tabatabai LB, Zimmerli MK, Zehr ES, Briggs RE, Tatum FM. 2010. Ornithobacterium rhinotracheale North American field isolates express a hemolysin-like protein. Avian Dis. 54:994-1001.

Uriarte J, Píscopo M, Origlia J, Gornatti D, Cerdá R, Herrero M, Petruccelli M. 2009. Primer aislamiento de Ornithobacterium rhinotracheale en Argentina. Analecta Vet. 29(2):53-55.

van Empel P & Hafez HM. 1999. Ornithobacterium rhinotracheale: a review. Avian Pathol. 28:217-228.

van Veen L, Gruys E, Frik K, van Empel P. 2000a. Increased condemnation of broilers associated with Ornithobacterium rhinotracheale. Vet. Rec. 147:422-423.

van Veen L, van Empel P, Fabri T. 2000b. Ornithobacterium rhinotrachale, a primary pathogen in broilers. Avian Dis. 44:896-900.

Walters J, Mainous M, Craig L, Evans R, Pierson FW. 2009. Unusual phenotypic characteristics of Ornithobacterium rhinotracheale in Virginia. Memorias 81st Northeastern Conference on Avian Diseases. Grantville, Pennsylvania, Estados Unidos de América. URL: http://www.ivis.org/proceedings/necad/2009/4.pdf. Acceso: Enero-2011.

 
Autor/es
(1210)
(1)
Re: Primeros aislamientos de Ornithobacterium rhinotracheale ß–hemolíticos en América Latina y su asociación a neumonía en pollos parrilleros
19/09/2011 | El título debe leerse: Primeros aislamientos de Ornithobacterium rhinotracheale ß–hemolíticos en América Latina y su asociación a neumonía en pollos parrilleros
(0)
(0)
¿Desea opinar en esta discusión sobre: Primeros aislamientos de Ornithobacterium rhinotracheale ß–hemolíticos en América Latina y su asociación a neumonía en pollos parrilleros?
Engormix se reserva el derecho de suprimir y/o modificar comentarios. Ver más detalles

No se publicarán comentarios que contengan:

  • Reiterados errores ortográficos y de escritura.
  • Anuncios publicitarios, direcciones de sitios Web y/o correos electrónicos.
  • Preguntas o respuestas que no tengan relación con el tema tratado en el foro.
PUBLICAR OPINIÓN
Los usuarios que leyeron este contenido, también vieron Enfermedades de las aves
Videos (12)
Detección de toxina distensora citoletal en cepas de Campylobacter jejuni
 
 
INTRODUCCIÓN Una de las causas de grandes perdidas en la avicultura m...
 
El género Salmonella (familia Enterobacteriaceae) incluye una larg...
Servicios Profesionales
Ing. Winfridus Bakker Ing. Winfridus Bakker
Springdale, Arkansas, Estados Unidos de América
Nestor Orlando Hernandez Vega Nestor Orlando Hernandez Vega
Nutley, New Jersey, Estados Unidos de América
Alejandro Banda Alejandro Banda
Flowood, Mississippi, Estados Unidos de América
Gabriel Sanchez Gabriel Sanchez
Athens, Georgia, Estados Unidos de América
    |     ¿Quiénes somos?     |     Publicite en Engormix
Copyright © 1999-2014 Engormix.com - All Rights Reserved